siGENOME Human AP1G1 (164) siRNA - SMARTpool

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	RNAi was performed using siRNAs (Dharmacon, Lafayette, CO) designed to the following human target sequences: AAUGCUCAGCAUCAGAGGCUC for the coding sequence of p56, AAGAAUGGAUUGAUGAU for the 5′ untranslated region of p56 (p56-5′), CAUCGUGUUCCAGUCAGCU for GGA1, UACACCUCUGGCUCAAGUG for GGA2, CAGUUUGUCCUCCGUGUUGG for GGA3, and UCCAAUUCGAAGACCAAUU for CHC. For the design of the siRNAs to the GGAs, an alignment of the cDNAs of the human sequences (Accession numbers: NM_013365 for GGA1; NM_015044 for GGA2; and NM_014001 for GGA3), using the multiple sequence alignment algorithm ClustalW (Thompson et al., 1994), was performed. We selected 18–20-base oligonucleotides directed to regions in the aligned coding sequences with the lowest degree of identity among the GGAs. Oligonucleotides with the ability to produce a knockdown of ≥90%, as assessed by immunoblot analysis, were chosen for further experiments. RNAi for human γ1-adaptin was performed with siGENOME Smart Pool siRNAs (Dharmacon). RNAi for GAPDH was performed with a siControl duplex siRNA (Dharmacon). Cells were transfected with the siRNAs using Oligofectamine (Invitrogen) according to the manufacturer's protocol. For knockdown of the GGAs, cells were transfected twice at 72-h intervals and analyzed 72 h after the second round of transfection. For knockdown of GAPDH, p56, γ1-adaptin, and CHC cells were transfected twice at 24-h intervals and analyzed 48 h after the second round of transfection.

Protocol tips

RNAi was performed using siRNAs (Dharmacon, Lafayette, CO) designed to the following human target sequences: AAUGCUCAGCAUCAGAGGCUC for the coding sequence of p56, AAGAAUGGAUUGAUGAU for the 5′ untranslated region of p56 (p56-5′), CAUCGUGUUCCAGUCAGCU for GGA1, UACACCUCUGGCUCAAGUG for GGA2, CAGUUUGUCCUCCGUGUUGG for GGA3, and UCCAAUUCGAAGACCAAUU for CHC. For the design of the siRNAs to the GGAs, an alignment of the cDNAs of the human sequences (Accession numbers: NM_013365 for GGA1; NM_015044 for GGA2; and NM_014001 for GGA3), using the multiple sequence alignment algorithm ClustalW (Thompson et al., 1994), was performed. We selected 18–20-base oligonucleotides directed to regions in the aligned coding sequences with the lowest degree of identity among the GGAs. Oligonucleotides with the ability to produce a knockdown of ≥90%, as assessed by immunoblot analysis, were chosen for further experiments. RNAi for human γ1-adaptin was performed with siGENOME Smart Pool siRNAs (Dharmacon). RNAi for GAPDH was performed with a siControl duplex siRNA (Dharmacon). Cells were transfected with the siRNAs using Oligofectamine (Invitrogen) according to the manufacturer's protocol. For knockdown of the GGAs, cells were transfected twice at 72-h intervals and analyzed 72 h after the second round of transfection. For knockdown of GAPDH, p56, γ1-adaptin, and CHC cells were transfected twice at 24-h intervals and analyzed 48 h after the second round of transfection.

Publication protocol

RNAi was performed using siRNAs (Dharmacon, Lafayette, CO) designed to the following human target sequences: AAUGCUCAGCAUCAGAGGCUC for the coding sequence of p56, AAGAAUGGAUUGAUGAU for the 5′ untranslated region of p56 (p56-5′), CAUCGUGUUCCAGUCAGCU for GGA1, UACACCUCUGGCUCAAGUG for GGA2, CAGUUUGUCCUCCGUGUUGG for GGA3, and UCCAAUUCGAAGACCAAUU for CHC. For the design of the siRNAs to the GGAs, an alignment of the cDNAs of the human sequences (Accession numbers: NM_013365 for GGA1; NM_015044 for GGA2; and NM_014001 for GGA3), using the multiple sequence alignment algorithm ClustalW (Thompson et al., 1994), was performed. We selected 18–20-base oligonucleotides directed to regions in the aligned coding sequences with the lowest degree of identity among the GGAs. Oligonucleotides with the ability to produce a knockdown of ≥90%, as assessed by immunoblot analysis, were chosen for further experiments. RNAi for human γ1-adaptin was performed with siGENOME Smart Pool siRNAs (Dharmacon). RNAi for GAPDH was performed with a siControl duplex siRNA (Dharmacon). Cells were transfected with the siRNAs using Oligofectamine (Invitrogen) according to the manufacturer's protocol. For knockdown of the GGAs, cells were transfected twice at 72-h intervals and analyzed 72 h after the second round of transfection. For knockdown of GAPDH, p56, γ1-adaptin, and CHC cells were transfected twice at 24-h intervals and analyzed 48 h after the second round of transfection.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing siRNA / miRNA gene silencing Human - HeLa γ1-adaptin/AP1G1 using siGENOME Human AP1G1 (164) siRNA - SMARTpool from Horizon Discovery Ltd..

Manufacturer protocol

Download the product protocol from Horizon Discovery Ltd. for siGENOME Human AP1G1 (164) siRNA - SMARTpool below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing siRNA / miRNA gene silencing Human - HeLa γ1-adaptin/AP1G1 using siGENOME Human AP1G1 (164) siRNA - SMARTpool from Horizon Discovery Ltd.. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.