Rn_Pdcd8_1 FlexiTube siRNA

siRNA / miRNA gene silencing Rat - H9c2 AIF/Pdcd8

Experiment
siRNA / miRNA gene silencing Rat - H9c2 AIF/Pdcd8
Product
Rn_Pdcd8_1 FlexiTube siRNA from Qiagen
Manufacturer
Qiagen

Protocol tips

Protocol tips
The H9c2 cell line was purchased from American Tissue Type Collection (Manassas, VA; Catalog # CRL – 1446). Cells were cultured in DMEM medium supplemented with 1.5 g/l sodium bicarbonate, 10% fetal bovine serum, 100 U/ml of penicillin and 100 μg/ml of streptomycin in 150 cm2 tissue culture flasks at 37 °C in a humidified atmosphere of 5% CO2. Cells were treated with 0.5 and 1 μM DOX for 6, 24 or 48 h, according to the assay.In the day prior to transfection, cells were plated in 60 mm-diameter plates at a density of 35,000 cells/ml in DMEM. Cells were approximately 60% confluent prior to transfection. On the day of transfection, cells were incubated with AIF small interfering RNA (siRNA) (Qiagen, catalog number SI03025379/Rn_Pdcd8_1, sequence: TTGGGTCGAAGGAGAGTAGAA), with On TargetPlus scrambled negative control (OT4, scrambled RNA) (Dharmacon, catalog number #11811994, sequence: UGGUUUACAUGUUUUCCUA) or with RNA buffer solution (negative control). In one tube, 6.7 μl/plate of siRNA against AIF mRNA or OT4 mRNA were diluted in Opti-MEM and siRNA buffer solution; in a separate tube, 6 μl/plate of Lipofectamine was diluted in 500 μl/plate of Opti-MEM. Both tubes were incubated for 5 min at room temperature, following which the two tubes (siRNA AIF with Lipofectamine or siRNA OT4 with Lipofectamine) were mixed together and incubated for another 20 min at room temperature to allow for the formation of transfection complexes. Plates were washed three times with PBS and filled with 1.5 ml of Opti-MEM. One milliliter aliquot of the solution was then added to each plate and gently mixed to ensure uniform distribution. The plates were then incubated at 37 °C humidified atmosphere containing 5% CO2 and 95% air for 5 h. Following this incubation, 2.5 ml of DMEM was added. The media were again changed to fresh DMEM after 24 h and cells were treated with DOX for the required experimental protocol.

Publication protocol

The H9c2 cell line was purchased from American Tissue Type Collection (Manassas, VA; Catalog # CRL – 1446). Cells were cultured in DMEM medium supplemented with 1.5 g/l sodium bicarbonate, 10% fetal bovine serum, 100 U/ml of penicillin and 100 μg/ml of streptomycin in 150 cm2 tissue culture flasks at 37 °C in a humidified atmosphere of 5% CO2. Cells were treated with 0.5 and 1 μM DOX for 6, 24 or 48 h, according to the assay.In the day prior to transfection, cells were plated in 60 mm-diameter plates at a density of 35,000 cells/ml in DMEM. Cells were approximately 60% confluent prior to transfection. On the day of transfection, cells were incubated with AIF small interfering RNA (siRNA) (Qiagen, catalog number SI03025379/Rn_Pdcd8_1, sequence: TTGGGTCGAAGGAGAGTAGAA), with On TargetPlus scrambled negative control (OT4, scrambled RNA) (Dharmacon, catalog number #11811994, sequence: UGGUUUACAUGUUUUCCUA) or with RNA buffer solution (negative control). In one tube, 6.7 μl/plate of siRNA against AIF mRNA or OT4 mRNA were diluted in Opti-MEM and siRNA buffer solution; in a separate tube, 6 μl/plate of Lipofectamine was diluted in 500 μl/plate of Opti-MEM. Both tubes were incubated for 5 min at room temperature, following which the two tubes (siRNA AIF with Lipofectamine or siRNA OT4 with Lipofectamine) were mixed together and incubated for another 20 min at room temperature to allow for the formation of transfection complexes. Plates were washed three times with PBS and filled with 1.5 ml of Opti-MEM. One milliliter aliquot of the solution was then added to each plate and gently mixed to ensure uniform distribution. The plates were then incubated at 37 °C humidified atmosphere containing 5% CO2 and 95% air for 5 h. Following this incubation, 2.5 ml of DMEM was added. The media were again changed to fresh DMEM after 24 h and cells were treated with DOX for the required experimental protocol.

Full paper   Login or join for free to view the full paper.

Reviews

Rn_Pdcd8_1 FlexiTube siRNA from Qiagen has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Start your discussion

Share your thoughts or question with experts in your field

Start a discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing siRNA / miRNA gene silencing Rat - H9c2 AIF/Pdcd8 using Rn_Pdcd8_1 FlexiTube siRNA from Qiagen.

View full paper   Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Qiagen for Rn_Pdcd8_1 FlexiTube siRNA below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing siRNA / miRNA gene silencing Rat - H9c2 AIF/Pdcd8 using Rn_Pdcd8_1 FlexiTube siRNA from Qiagen. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

  Outsource experiment
Become shareholder Discussions About us Contact Privacy Terms