Orai1 Rat siRNA Oligo Duplex (Locus ID 304496)

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	For siRNA and cDNA transfection, the Amaxa electroporation system was used (23) with the Amaxa cell line nucleofactor kit Transfection efficiency, judged by GFP fluorescence following transfection with a GFP plasmid, was typically 50– 60%. STIM1 siRNA was purchased from Life Technologies (catalog no. 4390815). Orai1 siRNA was bought from Origene Technologies (catalog no. SR508429), and the sequences (5 to 3 ) were AGUUCUUACCGCUCAAGAGGCAGGC, CCAUAAGACGGACCGACAGUUCCAG, and AGGGCAGAGUGUGGAAGGAAGAGGC. Both STIM1 and Oria1 siRNAs were used at a final concentration of 50 nM. PIP5K1 and PIP5K1 siRNAs and scrambled siRNA were purchased from Dharmacon and used at a final concentration of 75 nM. The PIP5K1 sequences (5 to 3 ) were CGGCAAGAACAUACGAAUU, GCAUCCGGCCUGACGAUUA, GCCCAUGAACAGCGAAAACA, and GAAAAUAGGCCAUCGAAGU. The PIP5K1 sequences (5 to 3 ) were UCUGGAGAGACUACGUAUA, GCUUCUAUGCCGAGCGCUU, GAGAGGAUGUGCAGUACGA, and GGAGGAGCUGCAUGCGGAA. Talin1 and talin2 siRNAs were from Dharmacon and used at 50 nM. The Talin1 SMARTpool sequences were CGAGAACUAUGCAGGUAUU, CGAAUGACCAAGGGUAUUA, GUUCGUAGAUUAUCAGACA, and GAGAUGAAGAGUCUACUAU. The Talin2 SMARTpool sequences were UGUUAGUACUCAAGGCGAA, CCGCAAUAAGUGUCGAAUU, CCGCAAAGCUCUUGGCCGA, and GCUAGAAGCAGGUCGGACA.

Protocol tips

For siRNA and cDNA transfection, the Amaxa electroporation system was used (23) with the Amaxa cell line nucleofactor kit Transfection efficiency, judged by GFP fluorescence following transfection with a GFP plasmid, was typically 50– 60%. STIM1 siRNA was purchased from Life Technologies (catalog no. 4390815). Orai1 siRNA was bought from Origene Technologies (catalog no. SR508429), and the sequences (5 to 3 ) were AGUUCUUACCGCUCAAGAGGCAGGC, CCAUAAGACGGACCGACAGUUCCAG, and AGGGCAGAGUGUGGAAGGAAGAGGC. Both STIM1 and Oria1 siRNAs were used at a final concentration of 50 nM. PIP5K1 and PIP5K1 siRNAs and scrambled siRNA were purchased from Dharmacon and used at a final concentration of 75 nM. The PIP5K1 sequences (5 to 3 ) were CGGCAAGAACAUACGAAUU, GCAUCCGGCCUGACGAUUA, GCCCAUGAACAGCGAAAACA, and GAAAAUAGGCCAUCGAAGU. The PIP5K1 sequences (5 to 3 ) were UCUGGAGAGACUACGUAUA, GCUUCUAUGCCGAGCGCUU, GAGAGGAUGUGCAGUACGA, and GGAGGAGCUGCAUGCGGAA. Talin1 and talin2 siRNAs were from Dharmacon and used at 50 nM. The Talin1 SMARTpool sequences were CGAGAACUAUGCAGGUAUU, CGAAUGACCAAGGGUAUUA, GUUCGUAGAUUAUCAGACA, and GAGAUGAAGAGUCUACUAU. The Talin2 SMARTpool sequences were UGUUAGUACUCAAGGCGAA, CCGCAAUAAGUGUCGAAUU, CCGCAAAGCUCUUGGCCGA, and GCUAGAAGCAGGUCGGACA.

Publication protocol

For siRNA and cDNA transfection, the Amaxa electroporation system was used (23) with the Amaxa cell line nucleofactor kit Transfection efficiency, judged by GFP fluorescence following transfection with a GFP plasmid, was typically 50– 60%. STIM1 siRNA was purchased from Life Technologies (catalog no. 4390815). Orai1 siRNA was bought from Origene Technologies (catalog no. SR508429), and the sequences (5 to 3 ) were AGUUCUUACCGCUCAAGAGGCAGGC, CCAUAAGACGGACCGACAGUUCCAG, and AGGGCAGAGUGUGGAAGGAAGAGGC. Both STIM1 and Oria1 siRNAs were used at a final concentration of 50 nM. PIP5K1 and PIP5K1 siRNAs and scrambled siRNA were purchased from Dharmacon and used at a final concentration of 75 nM. The PIP5K1 sequences (5 to 3 ) were CGGCAAGAACAUACGAAUU, GCAUCCGGCCUGACGAUUA, GCCCAUGAACAGCGAAAACA, and GAAAAUAGGCCAUCGAAGU. The PIP5K1 sequences (5 to 3 ) were UCUGGAGAGACUACGUAUA, GCUUCUAUGCCGAGCGCUU, GAGAGGAUGUGCAGUACGA, and GGAGGAGCUGCAUGCGGAA. Talin1 and talin2 siRNAs were from Dharmacon and used at 50 nM. The Talin1 SMARTpool sequences were CGAGAACUAUGCAGGUAUU, CGAAUGACCAAGGGUAUUA, GUUCGUAGAUUAUCAGACA, and GAGAUGAAGAGUCUACUAU. The Talin2 SMARTpool sequences were UGUUAGUACUCAAGGCGAA, CCGCAAUAAGUGUCGAAUU, CCGCAAAGCUCUUGGCCGA, and GCUAGAAGCAGGUCGGACA.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing siRNA / miRNA gene silencing Rat - RBL-2H3 Orai1 using Orai1 Rat siRNA Oligo Duplex (Locus ID 304496) from OriGene.

Manufacturer protocol

Download the product protocol from OriGene for Orai1 Rat siRNA Oligo Duplex (Locus ID 304496) below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing siRNA / miRNA gene silencing Rat - RBL-2H3 Orai1 using Orai1 Rat siRNA Oligo Duplex (Locus ID 304496) from OriGene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.