pSilencer™ 4.1-CMV neo

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	The human cervical carci¬noma cell lines SiHa was purchased from the American Type Culture Collection (ATCC) and cultured in complete RPMI-1640 medium (Gibco, Grand Island, NY, USA). shRNA expression vectors were generated by annealing single-stranded oligonu¬cleotides and inserting them into the BamHI and HindIII enzyme sites of pSilencer4.1-CMVneo vector (Ambion, Austin, TX, USA). The target sequences were as follows: shA1 (AEG-1; GenBank, AF411226.1; 1825 1843 bp): 5'-GTGCCG CCAATACTACAAG-3' (recommended by P.B. Fisher, Departments of Pathology and Urology, Columbia University, USA); shA2 (AEG-1; GenBank, AF411226.1; 666-686 bp): AACAGAAGAAGAAGAACCGGA (27); and a scrambled sequence was used as a negative control (NC): 5'-TTCTCC GAACGTGTCACGT-3' (provided by Ambion). The recombi¬nant shRNA vectors were named pshA1, pshA2 and pshNC. The full length open reading frame cDNA of AEG-1 was amplified using RT-PCR from total mRNA of HeLa cells, and then inserted into the pcDNA3.1 expression vector; the recom¬binant vector was named pAEG1. All recombinant vectors were confirmed by enzyme digestion and DNA sequencing analysis. Cell transfection was performed using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer's instructions and selected with 600 μg/ml of G418 (Invitrogen, San Diego, CA, USA) after transfection.

Protocol tips

The human cervical carci¬noma cell lines SiHa was purchased from the American Type Culture Collection (ATCC) and cultured in complete RPMI-1640 medium (Gibco, Grand Island, NY, USA). shRNA expression vectors were generated by annealing single-stranded oligonu¬cleotides and inserting them into the BamHI and HindIII enzyme sites of pSilencer4.1-CMVneo vector (Ambion, Austin, TX, USA). The target sequences were as follows: shA1 (AEG-1; GenBank, AF411226.1; 1825 1843 bp): 5'-GTGCCG CCAATACTACAAG-3' (recommended by P.B. Fisher, Departments of Pathology and Urology, Columbia University, USA); shA2 (AEG-1; GenBank, AF411226.1; 666-686 bp): AACAGAAGAAGAAGAACCGGA (27); and a scrambled sequence was used as a negative control (NC): 5'-TTCTCC GAACGTGTCACGT-3' (provided by Ambion). The recombi¬nant shRNA vectors were named pshA1, pshA2 and pshNC. The full length open reading frame cDNA of AEG-1 was amplified using RT-PCR from total mRNA of HeLa cells, and then inserted into the pcDNA3.1 expression vector; the recom¬binant vector was named pAEG1. All recombinant vectors were confirmed by enzyme digestion and DNA sequencing analysis. Cell transfection was performed using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer's instructions and selected with 600 μg/ml of G418 (Invitrogen, San Diego, CA, USA) after transfection.

Publication protocol

The human cervical carci¬noma cell lines SiHa was purchased from the American Type Culture Collection (ATCC) and cultured in complete RPMI-1640 medium (Gibco, Grand Island, NY, USA). shRNA expression vectors were generated by annealing single-stranded oligonu¬cleotides and inserting them into the BamHI and HindIII enzyme sites of pSilencer4.1-CMVneo vector (Ambion, Austin, TX, USA). The target sequences were as follows: shA1 (AEG-1; GenBank, AF411226.1; 1825 1843 bp): 5'-GTGCCG CCAATACTACAAG-3' (recommended by P.B. Fisher, Departments of Pathology and Urology, Columbia University, USA); shA2 (AEG-1; GenBank, AF411226.1; 666-686 bp): AACAGAAGAAGAAGAACCGGA (27); and a scrambled sequence was used as a negative control (NC): 5'-TTCTCC GAACGTGTCACGT-3' (provided by Ambion). The recombi¬nant shRNA vectors were named pshA1, pshA2 and pshNC. The full length open reading frame cDNA of AEG-1 was amplified using RT-PCR from total mRNA of HeLa cells, and then inserted into the pcDNA3.1 expression vector; the recom¬binant vector was named pAEG1. All recombinant vectors were confirmed by enzyme digestion and DNA sequencing analysis. Cell transfection was performed using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer's instructions and selected with 600 μg/ml of G418 (Invitrogen, San Diego, CA, USA) after transfection.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing shRNA gene silencing Human - SiHa AEG-1 using pSilencer™ 4.1-CMV neo from Thermo Fisher Scientific.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for pSilencer™ 4.1-CMV neo below.

Videos

Check out videos that might be relevant for performing shRNA gene silencing Human - SiHa AEG-1 using pSilencer™ 4.1-CMV neo from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.