XhoI R6161

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	The double-stranded 6His-HA-Vpr segment and the pcDNA3.1 vector were then digested with the respective restriction endonucleases HindIII and XhoI (Promega) and cloned by overnight ligation at 4°C with T4 DNA ligase (Promega).

Protocol tips
The double-stranded 6His-HA-Vpr segment and the pcDNA3.1 vector were then digested with the respective restriction endonucleases HindIII and XhoI (Promega) and cloned by overnight ligation at 4°C with T4 DNA ligase (Promega).

Publication protocol

For all studies, the noninfectious HIV-1 pNL4-3R+E− molecular clone was used (obtained through the National Institutes of Health (NIH) AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH, obtained from Dr. Nathaniel Landau (Connor et al., 1995; He et al., 1995)). To construct the 6His-HA-Vpr plasmid, two single-stranded DNA sequences (sense and antisense) were initially synthesized (Integrated DNA Technologies, Coralville, Iowa): AGCTTGCCACC ATGGGACATCATCACC ATCACCATTACCCATACGATGTTCCAGATTACGCTT and the reverse complement 5 – CCGGAAGCGTAATCTGGAACATCGTATGGGTAATGGTGATGGTGATGATGTC CCATGGTGGCA. The sense sequence incorporates a consensus Kozak sequence prior to the initial ATG transcription start site (in bold). The sense sequence also contains 6His and HA coding sequences underlined and double underlined, respectively. The 5′ end of the antisense sequence also contains an AccIII cleavage site. The sense and antisense sequences were annealed in 1× saline-sodium citrate solution, boiled for 5 min, and incubated for 1 h at 45°C. The double-stranded DNA sequence was subsequently digested with the AccIII restriction endonuclease (Promega, Madison WI) for 1 h at 65°C. The Vpr coding sequence was amplified by a polymerase chain reaction (PCR) assay from the pNL4-3R+E− molecular clone using forward (5′ – CGCATCCGGAGAACAAG CCCCAGAAGACC) and reverse (5′ – GCAGCTCGAGCTAGGATCTACTGGCTCC) PCR primers, engineered to harbor an AccIII and an XhoI restriction endonuclease cleavage site, respectively (underlined). The PCR-amplified fragment was digested with AccIII at 65°C for 1 h. The double-stranded DNA sequence containing the 6His and HA tags along with the Vpr PCR-amplified fragment (both containing the compatible AccIII overhangs) was then ligated overnight at 4°C with T4 DNA ligase (Promega). The double-stranded 6His-HA-Vpr segment and the pcDNA3.1 vector were then digested with the respective restriction endonucleases HindIII and XhoI (Promega) and cloned by overnight ligation at 4°C with T4 DNA ligase (Promega).

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Restriction Enzymes XhoI using XhoI R6161 from Promega.

Manufacturer protocol

Download the product protocol from Promega for XhoI R6161 below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Restriction Enzymes XhoI using XhoI R6161 from Promega. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.