KpnI R6341

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	The size of the amplified products was verified by agarose gel electrophoresis (Figure 4b), the PCR fragments were digested with KpnI (Promega, Madison, WI, USA) and HindIII (Promega), and then cloned between the KpnI and HindIII sites of the pGL3-Basic vector.

Protocol tips
The size of the amplified products was verified by agarose gel electrophoresis (Figure 4b), the PCR fragments were digested with KpnI (Promega, Madison, WI, USA) and HindIII (Promega), and then cloned between the KpnI and HindIII sites of the pGL3-Basic vector.

Publication protocol

The plasmid constructs used in this study are listed in the Table 1. The following Luciferase reporter vectors were obtained from Promega (Madison, WI, USA): pGL3-Basic, pGL-3-Control, and pRL-SV40. Constructs were prepared using standard recombination techniques (Sambrook and Maniatis, 1989). Briefly, the genomic DNA was extracted from peripheral blood lymphocytes, and BAX promoter was PCR amplified and sequenced as described earlier (Saxena et al., 2002), and two samples were selected, one with (subsequently referred to as ‘mutant’) and the other without G125A SNP (subsequently referred to as ‘wild type’). The samples did not have any other genetic changes in the amplified region (human BAX gene, 5′-region, GenBank Accession number U17193). Then, the genomic DNA was amplified using BLRGA-F (AAGGTACCAGGGGCGGTGTAGT) and BLRGA-R (CCAAGCTTGACTGTCCAATGAGCATC) primers: a site for KpnI is italicized and HindIII site is underlined (Table 1). The size of the amplified products was verified by agarose gel electrophoresis (Figure 4b), the PCR fragments were digested with KpnI (Promega, Madison, WI, USA) and HindIII (Promega), and then cloned between the KpnI and HindIII sites of the pGL3-Basic vector. The ligation mixture (5 μl) was electroporated into Escherichia coli strain DH5α using standard procedure and the Gene Pulser apparatus (Bio-Rad, 12 000 V/cm, 200 Ω). Recombinant plasmids were selected in the presence of Ampicillin (100 μg/ml), purified using Plasmid Purification kit (Qiagen Inc., Mississauga, Ontario, Canada), and screened for the presence of the KpnI/HindIII fragment by the agarose gel electrophoresis (Figure 4b). Two plasmids were created, the plasmid pGL3-BAXpr(w), with G nucleotide at the position 125, and the plasmid pGL3-BAXpr(m), with A at position 125 (Figure 4a, Table 1). The cloned fragments were verified by sequencing (Figure 4a) using 377 ABI Prism DNA Sequencer (Perkin-Elmer Inc., Foster City, CA, USA). The RVprimer 3 (clockwise primer) and GLprimer2 (counter clockwise primer) (Promega) were used (Figure 4a, Table 1).

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Restriction Enzymes KpnI using KpnI R6341 from Promega.

Manufacturer protocol

Download the product protocol from Promega for KpnI R6341 below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Restriction Enzymes KpnI using KpnI R6341 from Promega. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.