XcmI NEB#R0533

Protocol tips

Upstream tips	Protocol tips	Downstream tips
Successful mutagenesis is indicated by the loss of the restriction site and the presence of an undigested 281bp band after the XcmI (NEB) digest.	XcmI (NEB) restriction enzyme digest (3 hours, 37°C) results in the generation of 180bp and 101bp fragments.

Upstream tips
Successful mutagenesis is indicated by the loss of the restriction site and the presence of an undigested 281bp band after the XcmI (NEB) digest.
Protocol tips
XcmI (NEB) restriction enzyme digest (3 hours, 37°C) results in the generation of 180bp and 101bp fragments.

Publication protocol

We followed a published protocol for targeted TALEN mutagenesis [23]. klf2a genomic sequence was submitted to the Old TALEN Targeter software at https://tale-nt.cac.cornell.edu/node/add/talen-old. A target site at the 5`end of exon 2 5`TCAACCCATCACCACCTCCACCG/AT[ACACCACCAGCCTACTGGC]AGAGCTTCTGCAGTCTG 3`(19bp spacer sequence between target sequences for L and R TALEN subunits is annotated with square brackets) containing the XcmI (NEB) restriction enzyme site 5`CCANNNNNNNNNTGG 3`was chosen for the mutagenesis. Primers flanking the target site were designed amplifying a 281bp PCR product; klf2a TAL XcmI F 5`CAGGCGACTACAGAATGCAA 3`and klf2a TAL XcmI R 5`GCCCTCTTGTTTGACTTTGG 3`. Genomic DNA extraction was performed using REDExtract-N-Amp™ Tissue PCR Kit (SIGMA-ALDRICH). XcmI (NEB) restriction enzyme digest (3 hours, 37°C) results in generation of 180bp and 101bp fragments. Successful mutagenesis is indicated by the loss of the restriction site and the presence of an undigested 281bp band after the XcmI (NEB) digest. Following the assembly and capped mRNA synthesis, 1.5ng of capped mRNA coding for the klf2a TALEN construct was injected per embryo at one cell stage.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Restriction Enzymes XcmI using XcmI NEB#R0533 from New England BioLabs.

Manufacturer protocol

Download the product protocol from New England BioLabs for XcmI NEB#R0533 below.

Videos

Check out videos that might be relevant for performing Restriction Enzymes XcmI using XcmI NEB#R0533 from New England BioLabs. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.