NotI (10 U/µL)

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	Plasmid pPICZα was digested with EcoRI and NotI. The purified cAlyM fragment was ligated into plasmid pPICZα at the EcoRI and NotI sites.

Protocol tips
Plasmid pPICZα was digested with EcoRI and NotI. The purified cAlyM fragment was ligated into plasmid pPICZα at the EcoRI and NotI sites.

Publication protocol

"Restriction enzymes EcoRI, NotI, and SacI were purchased from Thermo Fisher Scientific (Waltham, MA, USA).The codon-optimized alginate lyase gene was amplified from pPIC9K-cAlyM by PCR using 5′-AGAGAGGCTGAAGCTGAATTCACTGAATCTGGTTCTGGTTCTTCTT-3′ as the upstream primer and 5′-TGTTCTAGAAAGCTGGCGGCCGCTTAGTGGTGATGGTGATGATGATC-3′ as the downstream primer. Plasmid pPICZα was digested with EcoRI and NotI. The purified cAlyM fragment was ligated into plasmid pPICZα at the EcoRI and NotI sites. The recombinant plasmid was named as pPICZα-cAlyM.

Site-directed mutagenesis was used to construct the mutant recombinant plasmid. The recombinant plasmid pPICZα-cAlyM was used as the template to amplify the mutation plasmids by PCR using the following primers: D102C-F: ATGTCCAATCTGTGGTTACAAGACTTCTACCAACACCTCC; D102C-R, TCTTGTAACCACAGATTGGACATCTGAACACCATACCAC, A300C-F: TACTGGTAACTGTTCCGACTACGTTCAGGTTACTTTCTAC, and A300C-R: CGTAGTCGGAACAGTTACCAGTATTGTTCTGGTTGTAAACAC. DpnI was used to remove the template DNA from the PCR product. The linearized PCR product was purified and ligated. The mutant recombinant plasmid was named as pPICZα-102C300C."

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Restriction Enzymes NotI using NotI (10 U/µL) from Thermo Fisher Scientific.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for NotI (10 U/µL) below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Restriction Enzymes NotI using NotI (10 U/µL) from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.