DdeI NEB#R0175

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	The amplified PCR product of 124 bp length was digested at 37 °C using one unit of DdeI (NEB, Beverly, MA, USA) restriction enzyme. This enzyme recognises the CTG sequence, originating in two fragments of 104 bp and 20 bp length. The wild-type allele (GG) produced one band (124 bp) while the wild type/variant allele (GA) produced three bands of 124 bp, 104 bp and 20 bp. The variant allele (AA) produced two bands of 104 bp and 20 bp length when run on 2.5% agarose gel electrophoresis.

Protocol tips

The amplified PCR product of 124 bp length was digested at 37 °C using one unit of DdeI (NEB, Beverly, MA, USA) restriction enzyme. This enzyme recognises the CTG sequence, originating in two fragments of 104 bp and 20 bp length. The wild-type allele (GG) produced one band (124 bp) while the wild type/variant allele (GA) produced three bands of 124 bp, 104 bp and 20 bp. The variant allele (AA) produced two bands of 104 bp and 20 bp length when run on 2.5% agarose gel electrophoresis.

Publication protocol

The detection of MC4R rs12970134 G > A was performed by PCR using specific primers (forward primer: GACTCTTACCAAACAAAGCCTG and reverse primer: TGCTAGGTTGGTCCTGGTTG). The reaction included denaturation at 94 °C for 10 min followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 58 °C for 45 s, elongation at 72 °C for 45 s and a final elongation step at 72 °C for 5 min. The amplified PCR product of 124 bp length was digested at 37 °C using one unit of DdeI (NEB, Beverly, MA, USA) restriction enzyme. This enzyme recognises the CTG sequence, originating in two fragments of 104 bp and 20 bp length. The wild-type allele (GG) produced one band (124 bp) while the wild type/variant allele (GA) produced three bands of 124 bp, 104 bp and 20 bp. The variant allele (AA) produced two bands of 104 bp and 20 bp length when run on 2.5% agarose gel electrophoresis.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Restriction Enzymes DdeI / HpyF3I using DdeI NEB#R0175 from New England BioLabs.

Manufacturer protocol

Download the product protocol from New England BioLabs for DdeI NEB#R0175 below.

Videos

Check out videos that might be relevant for performing Restriction Enzymes DdeI / HpyF3I using DdeI NEB#R0175 from New England BioLabs. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.