Eco91I (BstEII) (10 U/µL)

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	PCR product was digested by Eco91I restriction enzyme (Thermo Scientific, Dreieich, Germany) at 37 °C for 30 min according to the procedure provided by the manufacturer. Digested products were separated by electrophoresis on a 2% agarose gel in 0.5× of TBE buffer which was stained with ethidium bromide and visualized with a UV transilluminator [15, 16].

Protocol tips
PCR product was digested by Eco91I restriction enzyme (Thermo Scientific, Dreieich, Germany) at 37 °C for 30 min according to the procedure provided by the manufacturer. Digested products were separated by electrophoresis on a 2% agarose gel in 0.5× of TBE buffer which was stained with ethidium bromide and visualized with a UV transilluminator [15, 16].

Publication protocol

A DNA fragment which is a part of LEP gene was amplified using forward (5′TGCCCTCTCTCCCACTGA3′) and reverse (5′CTGGTGAGGATCTGTTGGTAGGTC 3′) primer pair which were designed using Primer3 online software (http://primer3.ut.ee/; [14]) based on the sequence of GenBank record HE605297.1. Polymerase chain reaction (PCR) was performed in 25 μl of reaction volume, which included 50 ng of genomic DNA, 50 ng of each primer, 200 μM of each dNTP, 2.5 μl of 10× PCR buffer, and 0·5 U of Taq DNA polymerase (Promega, Madison, WI, USA). Amplification was carried out in a thermocycler which was programmed as follows: an initial start separation cycle at 94 °C for 2 min, 35 cycles including a denaturation step at 94 °C for 30 s, an annealing step at 60 °C for 30 s, a polymerization step at 72 °C for 45 s, and a final extension cycle at 72 °C for 10 min. The PCR products were screened by electrophoresis on a 2% agarose gel in 0.5× of TBE buffer which was stained with ethidium bromide and visualized with an UV transilluminator. PCR product was digested by Eco91I restriction enzyme (Thermo Scientific, Dreieich, Germany) at 37 °C for 30 min according to the procedure provided by the manufacturer. Digested products were separated by electrophoresis on a 2% agarose gel in 0.5× of TBE buffer which was stained with ethidium bromide and visualized with an UV transilluminator [15, 16].

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Restriction Enzymes BstEII / Eco91I using Eco91I (BstEII) (10 U/µL) from Thermo Fisher Scientific.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for Eco91I (BstEII) (10 U/µL) below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Restriction Enzymes BstEII / Eco91I using Eco91I (BstEII) (10 U/µL) from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.