NdeI NEB#R0111

Restriction Enzymes NdeI

Experiment
Restriction Enzymes NdeI
Product
NdeI NEB#R0111 from New England BioLabs
Manufacturer
New England BioLabs

Protocol tips

Protocol tips
PCR products were digested with NdeI, ApaLI, and AccI (NEB) at 37°C, ethanol-precipitated, and run on denaturing polyacrylamide gels as described in ref. 15.

Publication protocol

Superscript II (Invitrogen) reverse transcription reactions, performed according to the supplied protocol, contained 5–10 μg of RNA and reverse primer GAATTCTAACCCCTGTGCTAGCGCTT for tissue culture experiments or a nested primer, ATGCTTTCAAGCATCTGACCTAACC, for mouse experiments. In all cases, 20% of the reverse transcription reaction was PCR-amplified by using Taq (Qiagen, Valencia, CA) with sense primer GAATTCCCAGACGTCGCTGCATGC and antisense primer GAATTCTAACCCCTGTGCTAGCGCTT. The sense primer was end-labeled by using T4 polynucleotide kinase (NEB, Beverly, MA) and was used at a 1:5 ratio with the unlabeled sense primer (15). PCR products were digested with NdeI, ApaLI, and AccI (NEB) at 37°C, ethanol-precipitated, and run on denaturing polyacrylamide gels as described in ref. 15.

Full paper   Login or join for free to view the full paper.

Reviews

NdeI NEB#R0111 from New England BioLabs has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Start your discussion

Share your thoughts or question with experts in your field

Start a discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Restriction Enzymes NdeI using NdeI NEB#R0111 from New England BioLabs.

View full paper   Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from New England BioLabs for NdeI NEB#R0111 below.

We haven't found the manufacturer protocol for this product yet.

Videos

Check out videos that might be relevant for performing Restriction Enzymes NdeI using NdeI NEB#R0111 from New England BioLabs. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

  Outsource experiment
Become shareholder Discussions About us Contact Privacy Terms