FastDigest NdeI

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	Amplified CdtB gene and vector were digested using thermo fast digest HindIII and NdeI enzymes.	After digestion, both vector and gene were gel purified and ligation was done using Takara T4 DNA ligase enzyme at 16 °C for 30 min.

Protocol tips
Amplified CdtB gene and vector were digested using thermo fast digest HindIII and NdeI enzymes.
Downstream tips
After digestion, both vector and gene were gel purified and ligation was done using Takara T4 DNA ligase enzyme at 16 °C for 30 min.

Publication protocol

Pet28a, which is a widely used expression vector for the production of recombinant protein, was used in the present study. Briefly, CdtB gene was amplified using forward 5′ TAAGCACATATGATGAAAAAACCTGTTTTTTT 3′ and reverse primer 5′ TGCTTAAAGCTTTTAACAGCTTCGTGCCAAAA3′ having sites for HindIII and NdeI restriction enzymes, respectively. Amplified CdtB gene and vector were digested using thermo fast digest HindIII and NdeI enzymes. After digestion, both vector and gene were gel purified and ligation was done using Takara T4 DNA ligase enzyme at 16 °C for 30 min. Transformation of recombinant DNA was done into E.coli BL21(DE3) host cells using CaCl2 method26. Transformed cells obtained on kanamycin-containing Luria-agar plates were checked for the presence of recombinant plasmid by extracting plasmid by alkaline lysis method. To confirm the integrity of the inserted DNA into the pET28a plasmid nucleotide sequencing analysis was also done. The vector was extracted from transformed BL21 (DE3) E.coli cells, purified using Qiagen gel purification kit and was sequenced using T7 promoter and terminator primers.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Restriction Enzymes NdeI using FastDigest NdeI from Thermo Fisher Scientific.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for FastDigest NdeI below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Restriction Enzymes NdeI using FastDigest NdeI from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.