AccI NEB#R0161

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	PCR products were digested with NdeI, ApaLI, and AccI (NEB) at 37°C, ethanol-precipitated, and run on denaturing polyacrylamide gels as described in ref. 15.

Protocol tips
PCR products were digested with NdeI, ApaLI, and AccI (NEB) at 37°C, ethanol-precipitated, and run on denaturing polyacrylamide gels as described in ref. 15.

Publication protocol

Superscript II (Invitrogen) reverse transcription reactions, performed according to the supplied protocol, contained 5–10 μg of RNA and reverse primer GAATTCTAACCCCTGTGCTAGCGCTT for tissue culture experiments or a nested primer, ATGCTTTCAAGCATCTGACCTAACC, for mouse experiments. In all cases, 20% of the reverse transcription reaction was PCR-amplified by using Taq (Qiagen, Valencia, CA) with sense primer GAATTCCCAGACGTCGCTGCATGC and antisense primer GAATTCTAACCCCTGTGCTAGCGCTT. The sense primer was end-labeled by using T4 polynucleotide kinase (NEB, Beverly, MA) and was used at a 1:5 ratio with the unlabeled sense primer (15). PCR products were digested with NdeI, ApaLI, and AccI (NEB) at 37°C, ethanol-precipitated, and run on denaturing polyacrylamide gels as described in ref. 15.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Restriction Enzymes AccI / XmiI using AccI NEB#R0161 from New England BioLabs.

Manufacturer protocol

Download the product protocol from New England BioLabs for AccI NEB#R0161 below.

Videos

Check out videos that might be relevant for performing Restriction Enzymes AccI / XmiI using AccI NEB#R0161 from New England BioLabs. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.