AsiSI NEB#R0630

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	Individual libraries were blunt‐ended using a PCRTerminator® end repair kit (Lucigen, http://www.lucigen.com), digested with either AscI or AsiSI (NEB, http://www.neb.com), and ligated into the pre‐cut binary vector (pSR486). pSR486 was pre‐digested with either AscI and PmeI (for sense library orientation) or with AsiSI and BstZ17I (for antisense orientation), followed by dephosphorylation using Antarctic phosphatase (NEB).

Protocol tips

Individual libraries were blunt‐ended using a PCRTerminator® end repair kit (Lucigen, http://www.lucigen.com), digested with either AscI or AsiSI (NEB, http://www.neb.com), and ligated into the pre‐cut binary vector (pSR486). pSR486 was pre‐digested with either AscI and PmeI (for sense library orientation) or with AsiSI and BstZ17I (for antisense orientation), followed by dephosphorylation using Antarctic phosphatase (NEB).

Publication protocol

The Super SMART™ PCR cDNA synthesis kit (Clontech, http://www.clontech.com/), with modifications, was used to construct both cauline leaf and laser‐microdissected cDNA libraries. Ten nanograms of DNAse I‐treated cauline leaf RNA or captured mesophyll cell RNA were reverse transcribed as described in the Clontech manual, except that modified 3′ SMART CDS Primer II A primers (5′‐AAGCAGTGGTATCAACGCAGAGTGGCGCGCCT(25)KN‐3′, containing an AscI site, for constructing sense libraries, and 5′‐AAGCAGTGGTATCAACGCAGAGTGCGATCGCT(25)KN‐3′, containing an AsiSI site, for antisense libraries) were used to aid in directional cloning of the libraries. Second‐strand cDNA was generated using long distance PCR (LD‐PCR) (19–21 cycles) according to the Clontech protocol, and purified using MicroSpin™ S‐400 HR columns (Illustra, http://www5.gelifesciences.com). The cDNA was subsequently diluted to a concentration of 2.5 ng μl−1 and amplified a second time (approximately 13 cycles). Individual libraries were blunt‐ended using a PCRTerminator® end repair kit (Lucigen, http://www.lucigen.com), digested with either AscI or AsiSI (NEB, http://www.neb.com), and ligated into the pre‐cut binary vector (pSR486). pSR486 was pre‐digested with either AscI and PmeI (for sense library orientation) or with AsiSI and BstZ17I (for antisense orientation), followed by dephosphorylation using Antarctic phosphatase (NEB).

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Restriction Enzymes AsiSI / SfaAI / SgfI using AsiSI NEB#R0630 from New England BioLabs.

Manufacturer protocol

Download the product protocol from New England BioLabs for AsiSI NEB#R0630 below.

Videos

Check out videos that might be relevant for performing Restriction Enzymes AsiSI / SfaAI / SgfI using AsiSI NEB#R0630 from New England BioLabs. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.