SacII restriction enzyme

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	The pMD18-T-2B plasmid was digested with SacII (TaKaRa) and PacI (NEB), and 2B was inserted into the pGBHCupp-2A MCS site via the same restriction enzyme digestion and ligated to create the plasmid pGBHCupp-2A2B.

Protocol tips
The pMD18-T-2B plasmid was digested with SacII (TaKaRa) and PacI (NEB), and 2B was inserted into the pGBHCupp-2A MCS site via the same restriction enzyme digestion and ligated to create the plasmid pGBHCupp-2A2B.

Publication protocol

For homologous recombination in L. casei ATCC 393, upstream homologous arm 2A (1,021 bp) and downstream homologous arm 2B (768 bp) were PCR amplified using L. casei ATCC 393 genomic DNA as a template to create an internal 651-bp deletion in the upp gene site. The sense primer for homologous arm 2A was GATCTAGATCAAAGCGGCGCGCCGGCAGCCCAGTTAGTT (BglII), and the antisense primer was TTGGCGCGCCAAGGCTCCTCCTAAACGCATTC (AscI). The sense primer for homologous arm 2B was ACCTTAATTAAATTCTTTGGCATGTGTAAAA (PacI), and the antisense primer was TCCCCGCGGGGAAGGTTGATCGGAAGCA (SacII). The two PCR fragments were gel purified and inserted into the pMD18-T vector (TaKaRa). Correct inserts were identified by sequencing. The pMD18-T-2A plasmid was digested with BglII (TaKaRa) and AscI (NEB). 2A was inserted into the pGBHCupp vector MCS site using the same restriction enzyme digestion, and this construct was named pGBHCupp-2A. The pMD18-T-2B plasmid was digested with SacII (TaKaRa) and PacI (NEB), and 2B was inserted into the pGBHCupp-2A MCS site via the same restriction enzyme digestion and ligated to create the plasmid pGBHCupp-2A2B.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Restriction Enzymes SacII / Cfr42I using SacII restriction enzyme from Takara Bio Inc.

Manufacturer protocol

Download the product protocol from Takara Bio Inc for SacII restriction enzyme below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Restriction Enzymes SacII / Cfr42I using SacII restriction enzyme from Takara Bio Inc. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.