FastDigest BglII

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	We digest the amplicon and pBAD-Ara::cmyc-His with FastDigest NcoI and FastDigest BgIII (both ThermoFischer Scientific) for 30min in Fast Digest buffer according to the supplier’s double digestion protocol. We treated the vector with alkaline phosphatase (NEB) at 37°C for 1h to avoid recircularization.

Protocol tips
We digest the amplicon and pBAD-Ara::cmyc-His with FastDigest NcoI and FastDigest BgIII (both ThermoFischer Scientific) for 30min in Fast Digest buffer according to the supplier’s double digestion protocol. We treated the vector with alkaline phosphatase (NEB) at 37°C for 1h to avoid recircularization.

Publication protocol

"The nucleotide sequences for BtsCI restriction enzyme (btsCIR) and the respective methyltransferase (btsCIM) were obtained from NCBI (Accession no GQ449683) and the plasmids were obtained from New England Biolabs (NEB). We decided to reclone btsciR into pBAD-Ara::cmyc-His (ampicilinR). We started by preparing the insert by PCR amplification of the btsciR sequence with the following oligos:

EF_NcoI_BtsCIR_Fw: 5´CCACCATGGGTAAACGAATTTTATACTTGCTAACT3´

EF_BglII_ BtsCIR_NO STOP_RV: 5´CCAAGATCTCAGAAAAACAGCGCTTCCAT3´ and a PCR program starting with 30s at 98°C followed by 30 cycles of 10s at 98°C, 30s at 68°C and 72°C for 45s, and finishing with 10min at 72°C. We used 0,2μL (0.4U) of Phusion High-Fidelity DNA polymerase (ThermoFischer Scientific) in 1μL of DNA template with 1μL of each of the aforementioned primers (final concentration of 0.5μM), 4μL of HF Buffer, 0.4μL of 10mM dNTPs and water up 20μL. It is important to notice that in the EF_BglII_ BtsCIR_NO STOP_RV oligo we do not include the STOP codon of the gene in order to obtain a fusion with a c-myc fragment and a His-tag, which were used for purification later. We digest the amplicon and pBAD-Ara::cmyc-His with FastDigest NcoI and FastDigest BgIII (both ThermoFischer Scientific) for 30min in Fast Digest buffer according to the supplier’s double digestion protocol. We treated the vector with alkaline phosphatase (NEB) at 37°C for 1h to avoid recircularization. A 1:5 vector:insert was incubated with T4 DNA Ligase (ThermoFischer Scientific) at 22°C O/N. The reaction product was dialysed to MiliQ water for 1h using dialysis disks.

The methyltransferase gene was obtained in the vector pACYC184. We electroporated pACYC184:btsciM (chloramphenicolR) into Escherichia coli D1210 (F- mcrB mrr hsdS20(rB- mB-) recA13 leuB6 ara-14 proA2 lacY1 galK2 xyl-5 mtl-1 rpsL20(SmR) glnV44 λ- lacIq lacY+) and allowed the bacteria to grow for 1h in LB before plating in agar with chloramphenicol (25μg/mL). After confirmation of a successful transformation by Sanger sequencing, we electroporated the resulting bacteria (D1210+pACYC184::btsciM) with the pBAD-Ara::btsciR-cmyc-His-tag construct and repeated the growth procedure by plating in agar with chloramphenicol (25μg/mL) and ampicillin (100 μg/mL). Glucose was also added to the plates (0.2% final concentration) to avoid leakage from the pBAD-Ara promoter."

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Restriction Enzymes BglII using FastDigest BglII from Thermo Fisher Scientific.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for FastDigest BglII below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Restriction Enzymes BglII using FastDigest BglII from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.