pET-21b-VP24

Protein Expression Prokaryotic cells - E. coli VP24

Experiment
Protein Expression Prokaryotic cells - E. coli VP24
Product
pET-21b-VP24 from Yunkun Wu, State Key Laboratory of Structural Chemistry, Fujian
Manufacturer
Yunkun Wu, State Key Laboratory of Structural Chemistry, Fujian

Protocol tips

Protocol tips
All recombinant plasmids were transformed into Escherichia coli BL21 (DE3) cells. Overexpression was performed by the induction of mid-log-phase E. coli BL21 (DE3) cells with 0.3 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) for 12–16 h at 16°C.
Downstream tips
The overexpressed VP24-His6 was purified using Ni–NTA affinity chromatography (GE Healthcare) followed by gel filtration using Superdex 200 HR 16/60 (GE Healthcare) equilibrated in a buffer consisting of 25 mM Tris–HCl pH 7.0, 200 mM NaCl, 5% glycerol.

Publication protocol

The gene coding for the transmembrane region-truncated construct of VP24 (residues 27–208; Table 1▸) was amplified from the WSSV genome by PCR using specific primers: forward primer GCCTCATATGAACATAGAACTTAAC and reverse primer GCCCTCGAGTTTTTCCCCAACC. The PCR products were digested with NdeI and XhoI and further cloned into pET-21b, resulting in a C-terminal hexahistidine tag for purification. The mutants (L69M, L88M, L121M, I133M and L69M/L121M) were generated by site-directed mutagenesis using the pET-21b-VP24 vector as the template and were confirmed by sequencing. All recombinant plasmids were transformed into Escherichia coli BL21 (DE3) cells. Overexpression was performed by the induction of mid-log-phase E. coli BL21 (DE3) cells with 0.3 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) for 12–16 h at 16°C. The overexpressed VP24-His6 was purified using Ni–NTA affinity chromatography (GE Healthcare) followed by gel filtration using Superdex 200 HR 16/60 (GE Healthcare) equilibrated in a buffer consisting of 25 mM Tris–HCl pH 7.0, 200 mM NaCl, 5% glycerol. Purified protein fractions were made 0.5 M in the nondetergent sulfobetaine 3-(1-pyridino)-1-propanesulfonate (NDSB-201; Sigma) and then concentrated using centrifugal concentrators to a final concentration of 2.5–3.5 mg ml−1; the concentration was measured using a Bradford Protein Assay kit (Bio-Rad). Selenomethinonine (SeMet)-labelled proteins were produced by inhibiting endogenous methionine biosynthesis in M9 minimal medium supplemented with specific amino acids as well as SeMet (Qoronfleh et al., 1995 ▸; Hendrickson et al., 1990 ▸). The purification and concentration steps were the same as for the corresponding native protein. The purification-step results, shown by SDS–PAGE, are shown in Figs. 1▸ and 2▸. Macromolecule-production information is summarized in Table 1▸.

Full paper   Login or join for free to view the full paper.

Reviews

pET-21b-VP24 from Yunkun Wu, State Key Laboratory of Structural Chemistry, Fujian has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Start your discussion

Share your thoughts or question with experts in your field

Start a discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Protein Expression Prokaryotic cells - E. coli VP24 using pET-21b-VP24 from Yunkun Wu, State Key Laboratory of Structural Chemistry, Fujian .

View full paper   Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Yunkun Wu, State Key Laboratory of Structural Chemistry, Fujian for pET-21b-VP24 below.

We haven't found the manufacturer protocol for this product yet.

Videos

Check out videos that might be relevant for performing Protein Expression Prokaryotic cells - E. coli VP24 using pET-21b-VP24 from Yunkun Wu, State Key Laboratory of Structural Chemistry, Fujian . Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

  Outsource experiment
Become shareholder Discussions About us Contact Privacy Terms