Protocol tips
| Upstream tips |
Protocol tips |
Downstream tips |
| Cloning for Cry5B expression by the leaky Lactococcus system was accomplished using vector pTRK1061. The vector was constructed from pTRK617 (24) by using an XhoI/SalI double digest and religation, removing the tetanus toxin fragment C (TTFC) gene. The following primers were used to amplify cry5B from pTRK1040: forward, Cry5B RBS PstI (GATCCTGCAGAAGGAGAACGTATATGGCAACAATTAATGAGTTGTATC); and reverse, Cry5B XhoI R (GATCCTCGAGTATCCAAGCTCAGCTAATTAAG). The reverse primer for truncated Cry5B was tCry5B XhoI R (GATCCTCGAGATCAGTCTATTGGATTTTTGGAAC). The Cry5B fragments and vector pTRK1061 were digested with PstI and XhoI and ligated. |
|
|
| Upstream tips |
| Cloning for Cry5B expression by the leaky Lactococcus system was accomplished using vector pTRK1061. The vector was constructed from pTRK617 (24) by using an XhoI/SalI double digest and religation, removing the tetanus toxin fragment C (TTFC) gene. The following primers were used to amplify cry5B from pTRK1040: forward, Cry5B RBS PstI (GATCCTGCAGAAGGAGAACGTATATGGCAACAATTAATGAGTTGTATC); and reverse, Cry5B XhoI R (GATCCTCGAGTATCCAAGCTCAGCTAATTAAG). The reverse primer for truncated Cry5B was tCry5B XhoI R (GATCCTCGAGATCAGTCTATTGGATTTTTGGAAC). The Cry5B fragments and vector pTRK1061 were digested with PstI and XhoI and ligated. |
Publication protocol
Cloning for Cry5B expression by the leaky Lactococcus system was accomplished using vector pTRK1061. The vector was constructed from pTRK617 (24) by using an XhoI/SalI double digest and religation, removing the tetanus toxin fragment C (TTFC) gene. The following primers were used to amplify cry5B from pTRK1040: forward, Cry5B RBS PstI (GATCCTGCAGAAGGAGAACGTATATGGCAACAATTAATGAGTTGTATC); and reverse, Cry5B XhoI R (GATCCTCGAGTATCCAAGCTCAGCTAATTAAG). The reverse primer for truncated Cry5B was tCry5B XhoI R (GATCCTCGAGATCAGTCTATTGGATTTTTGGAAC). The Cry5B fragments and vector pTRK1061 were digested with PstI and XhoI and ligated.
Full paper
Login or
join for free to view the full paper.
Reviews
pTRK1061 from Todd R. Klaenhammer, Department of Food, Bioprocessing and Nutri has not yet been reviewed for this experiment
We'd love it if you would be the first to write a review!
Discussion
Start your discussion
Share your thoughts or question with experts in your field
Start a discussion
Papers
Check out relevant papers found by Labettor's AI that are relevant for performing Protein Expression Prokaryotic cells - L. lactis Cry5B using pTRK1061 from Todd R. Klaenhammer, Department of Food, Bioprocessing and Nutri.
Manufacturer protocol
Download the product protocol from Todd R. Klaenhammer, Department of Food, Bioprocessing and Nutri for pTRK1061 below.
We haven't found the manufacturer protocol for this product yet.
Videos
Check out videos that might be relevant for performing Protein Expression Prokaryotic cells - L. lactis Cry5B using pTRK1061 from Todd R. Klaenhammer, Department of Food, Bioprocessing and Nutri. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.
We haven't found any additional videos for this experiment / product combination yet.