pMSP3535H3

Protocol tips

Upstream tips	Protocol tips	Downstream tips
For nisin-induced expression of Cry5B by use of vector pMSP3535H3, full-length and truncated cry5B genes were PCR amplified from pTRK1040 by using the following primers: cry5B SphI forward (GATCGCATGCGTGAGGAGAACGTATATGGCAACAATTAATGAGTTG) and cry5B BamHI reverse (GATCGGATCCGCAGTATCCAAGCTCAGCTAATTAAG). Truncated Cry5B was amplified with truncated cry5B BamHI reverse (GATCGGATCCGCAGTATCCAAGCTCAGCTAATTAAG). The PCR products were cloned into vector pSC-B by using a StrataClone Blunt PCR cloning kit, and from there into pMSP3535H3 by using the SphI and BamHI restriction sites encoded in the PCR primers.

Upstream tips

For nisin-induced expression of Cry5B by use of vector pMSP3535H3, full-length and truncated cry5B genes were PCR amplified from pTRK1040 by using the following primers: cry5B SphI forward (GATCGCATGCGTGAGGAGAACGTATATGGCAACAATTAATGAGTTG) and cry5B BamHI reverse (GATCGGATCCGCAGTATCCAAGCTCAGCTAATTAAG). Truncated Cry5B was amplified with truncated cry5B BamHI reverse (GATCGGATCCGCAGTATCCAAGCTCAGCTAATTAAG). The PCR products were cloned into vector pSC-B by using a StrataClone Blunt PCR cloning kit, and from there into pMSP3535H3 by using the SphI and BamHI restriction sites encoded in the PCR primers.

Publication protocol

For nisin-induced expression of Cry5B by use of vector pMSP3535H3, full-length and truncated cry5B genes were PCR amplified from pTRK1040 by using the following primers: cry5B SphI forward (GATCGCATGCGTGAGGAGAACGTATATGGCAACAATTAATGAGTTG) and cry5B BamHI reverse (GATCGGATCCGCAGTATCCAAGCTCAGCTAATTAAG). Truncated Cry5B was amplified with truncated cry5B BamHI reverse (GATCGGATCCGCAGTATCCAAGCTCAGCTAATTAAG). The PCR products were cloned into vector pSC-B by using a StrataClone Blunt PCR cloning kit, and from there into pMSP3535H3 by using the SphI and BamHI restriction sites encoded in the PCR primers.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Protein Expression Prokaryotic cells - L. lactis Cry5B using pMSP3535H3 from Todd R. Klaenhammer, Department of Food, Bioprocessing and Nutri.

Manufacturer protocol

Download the product protocol from Todd R. Klaenhammer, Department of Food, Bioprocessing and Nutri for pMSP3535H3 below.

Videos

Check out videos that might be relevant for performing Protein Expression Prokaryotic cells - L. lactis Cry5B using pMSP3535H3 from Todd R. Klaenhammer, Department of Food, Bioprocessing and Nutri. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.