YeaStar™ Genomic DNA Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	Susceptibility to yeast lytic enzymes varies for different yeast species. If you see incomplete lysis, extend the first incubation time up to 2 hours or over 16 hours.

Protocol tips
Susceptibility to yeast lytic enzymes varies for different yeast species. If you see incomplete lysis, extend the first incubation time up to 2 hours or over 16 hours.

Publication protocol

Polymerase chain reaction (PCR)
Genomic DNA was extracted using the YeaStar™ Genomic DNA kit (Zymo Research Corporation, Irvine, CA, USA) following the manufacturer's recommendations. DNA concentrations were measured on a NanoDrop 2000 spectrophotometer (wavelength 260 nm) (Thermo Scientific, Wilmington, DE, USA). Multiplex PCR was performed with DreamTaq PCR Master Mix (2×) (Thermo Fisher Scientific). Primers specific for S. cerevisiae (Scer F2: GCGCTTTACATTCAGATCCCG AG and Scer R2: TAAGTTGGTTGTCAGCAAGATTG) and S. eubayanus (Seub F3: GTCCCTGTACCAATTTAATATTGCGC and Seub R2: TTTCACATCTCTTAGTCTTTTCCAGACG), as described by Pengelly and Wheals (2013), were used at a concentration of 300 nM. Cycling parameters were 94°C for 2 min, then 35 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 60 s, followed by a 10 min incubation at 72°C. A total of 10 μL samples from each reaction were analyzed by electrophoresis on a 2% (w/v) agarose gel in 0.5× TBE buffer (45 mM Tris-borate pH 8.0 1 mM EDTA), supplemented with SERVA DNA stain G (SERVA Electrophoresis, Heidelberg, Germany) for 40 min at 120 V.



Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing DNA isolation / purification Yeast - Saccharomyces cerevisiae using YeaStar™ Genomic DNA Kit from Zymo Research.

Manufacturer protocol

Download the product protocol from Zymo Research for YeaStar™ Genomic DNA Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing DNA isolation / purification Yeast - Saccharomyces cerevisiae using YeaStar™ Genomic DNA Kit from Zymo Research. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.