DNeasy PowerWater Kit (100)

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	Follow manufacturer's instructions

Protocol tips
Follow manufacturer's instructions

Publication protocol

DNA extraction and sequencing: DNA was extracted using the DNeasy PowerWater Kit (Qiagen) following manufacturer protocols and stored at −80 °C until sequencing. Bacterial communities were identified using the 27f (5′-3′: AGAGTTTGATCMTGGCTCAG31) and 519r (5′-3′: GWATTACCGCGGCKGCTG32) primers for the V1-V3 region of the 16 S rRNA gene and Illumina™ MiSeq. 2 × 300 base pair (bp), paired-end v2 sequencing runs across two (2) lanes. Eukaryotic composition was determined using the 1391 f (5′-3′: GTACACACCGCCCGTC) and EukBr (5′-3′: TGATCCTTCTGCAGGTTCACCTAC) primer set33 for the V9 region of the 18S rRNA gene and Illumina™ MiSeq. 2 × 150 bp paired-end v3 sequencing runs across two (2) lanes. All sequencing was done at the Ramaciotti Centre for Genomics (UNSW Sydney). All raw sequence data are publicly available through the National Center for Biotechnology Information (NCBI)34 under SRA study accession SRP224901. The SRA data record includes 1,596 experiments derived from 1,476 samples.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing DNA isolation / purification Water samples using DNeasy PowerWater Kit (100) from Qiagen.

Manufacturer protocol

Download the product protocol from Qiagen for DNeasy PowerWater Kit (100) below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing DNA isolation / purification Water samples using DNeasy PowerWater Kit (100) from Qiagen. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.