EZ DNA Methylation kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
For best results, the CT Conversion Reagent should be prepared freshly and used immediately following preparation.	Always include fully methylated (in-vitro methylated DNA) and non-methylated controls (Leucocyte DNA, DNMT1/3 double KO DNA) during MSP

Upstream tips
For best results, the CT Conversion Reagent should be prepared freshly and used immediately following preparation.
Protocol tips
Always include fully methylated (in-vitro methylated DNA) and non-methylated controls (Leucocyte DNA, DNMT1/3 double KO DNA) during MSP

Publication protocol

rDNA methylation analysis
To investigate rDNA methylation levels of donor cells, partially reprogrammed cells and iPSCs, MEFs, S-MEFs, Day 6 MEFs, Day 6 S-MEFs, iPSCs-A1, S-iPSCs-B3, and R1 ESCs were collected. Genomic DNA was converted using the EZ DNA Methylation-Direct™ kit (ZYMO Research, Irvine, CA, USA) according to the manufacturer’s instructions. rDNA promoter was PCR amplified using primers TAGTTTATTTTTTTTATTGGTTTGG (forward) and TAACATAAACACTTAAACACCACAA (reverse) as designed previously by our laboratory [19]. The PCR products were cloned into T3 vectors. At least 10 randomly selected clones for each sample were sequenced and analyzed.



Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing DNA methylation profiling Whole genome profiling - mouse iPSCs using EZ DNA Methylation kit from Zymo Research.

Manufacturer protocol

Download the product protocol from Zymo Research for EZ DNA Methylation kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing DNA methylation profiling Whole genome profiling - mouse iPSCs using EZ DNA Methylation kit from Zymo Research. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.