HiPerFect Transfection Reagent

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	Dilute siRNA in culture medium without serum. Incubate the samples for 5–10 min at room temperature

Protocol tips
Dilute siRNA in culture medium without serum. Incubate the samples for 5–10 min at room temperature

Publication protocol

All siRNAs, miR-708 mimic, anti-miR-708 and negative control oligoes were synthesized by GenScript (Nanjing, China). Primer sequences for quantitative analysis of mRNAs are available upon request. The target sequence for Mapk14 siRNA: 5' GGACCTCCTTATAGACGAA 3'. The target sequence for negative control siRNA: 5' AGTCGCATACCTCGACAATAAT 3'. The miRNA mimic sequences for WT and mutation miR-708 are: WT, 5' AAGGAGCUUACAAUCUAGCUGGG 3'; mutation, 5' AUCGACCUUACUAUCUAGCUGGG 3'. The HiPerFect transfection reagent from Qiagen was used for cell transfection following the manufacturer's instructions. Final concentration of 30 nM of small RNA oligoes was used for all in vitro assays.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing siRNA / RNAi /miRNA transfection Rat - H9c2 Cationic and neutral lipids using HiPerFect Transfection Reagent from Qiagen.

Manufacturer protocol

Download the product protocol from Qiagen for HiPerFect Transfection Reagent below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing siRNA / RNAi /miRNA transfection Rat - H9c2 Cationic and neutral lipids using HiPerFect Transfection Reagent from Qiagen. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.