HiPerFect Transfection Reagent

Protocol tips

Upstream tips	Protocol tips	Downstream tips
Seed 0.4–1.6 x 105 cells per well	Dilute siRNA in culture medium without serum. Incubate the samples for 5–10 min at room temperature

Upstream tips
Seed 0.4–1.6 x 105 cells per well
Protocol tips
Dilute siRNA in culture medium without serum. Incubate the samples for 5–10 min at room temperature

Publication protocol

A β-catenin short hairpin RNA (shRNA) (target sequence AACATGCAGTTGTCAATTTGA) or its scrambled control (target sequence GCAATTCTGAAGTCTGATATA) was inserted into the pSilencer 3.0 H1 vector per the manufacturer's instructions. siRNAs (Sigma-Aldrich) for MEF2A (siRNA 1, SASI_Mm01_00120788; and siRNA 2, SASI_Mm01_00120789), MEF2C (SASI_Mm01_00092891), and β-catenin (SASI_Rn01_00099923) and a universal scrambled RNA were used at a concentration of 25 nM. Double-siRNA experiments used a 25 nM concentration of each siRNA (total concentration, 50 nM), and equivalent controls used 50 nM scrambled RNA.


Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing siRNA / RNAi /miRNA transfection Rat - C6 Cationic lipid based using HiPerFect Transfection Reagent from Qiagen.

Manufacturer protocol

Download the product protocol from Qiagen for HiPerFect Transfection Reagent below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing siRNA / RNAi /miRNA transfection Rat - C6 Cationic lipid based using HiPerFect Transfection Reagent from Qiagen. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.