HiPerFect Transfection Reagent

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	Dilute siRNA in culture medium without serum. Incubate the samples for 5–10 min at room temperature

Protocol tips
Dilute siRNA in culture medium without serum. Incubate the samples for 5–10 min at room temperature

Publication protocol

ClC‐3 siRNA (GeneBank Accession No. NM_053363, 5′‐GGAUGACUGACCUGAAAGATT‐3′) and ROCK2 siRNA (GeneBank Accession No. NM_013022, 5′‐GAGCAACAUGGAAAUAGAUAUGACA‐3′) were designed and synthesized by Invitrogen (Carlsbad, USA). Scrambled RNA was used as negative control. ClC‐3 siRNA, ROCK2 siRNA and negative RNA was transfected into A10 cells by using HiPerfect transfection reagent according to the protocol previously described (Liu et al., 2010).

Plasmids were transfected into the cells with LipofectAMINE2000 reagent in OPTI‐MEMRI reduced serum medium according to the protocol previously described (Liu et al., 2010).

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing siRNA / RNAi /miRNA transfection Rat - A-10 Cationic lipid based using HiPerFect Transfection Reagent from Qiagen.

Manufacturer protocol

Download the product protocol from Qiagen for HiPerFect Transfection Reagent below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing siRNA / RNAi /miRNA transfection Rat - A-10 Cationic lipid based using HiPerFect Transfection Reagent from Qiagen. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.